Assay objective: To co-capture viral integration sites and intact-proviral-genomes from single templates. See Einkauf et al.
| Second round MipSeq Primers | |||||||
| HIV-1 HXB2 Start and End Coordinates and Regions | |||||||
| Primer | Sequence | Start | End | Gene | gene_start | gene_stop | direction |
|---|---|---|---|---|---|---|---|
| 1 | |||||||
| 2.5 | 5'-CCTAGGAAAAAGGGCTGTTGGAAATGTGG-3' | 2,011 | 2,039 | gag | 1222 | 1250 | fw |
| RT3789R | 5'-CAAACTCCCACTCAGGAATCCA-3' | 3,777 | 3,798 | pol | 1693 | 1714 | rc |
| 2 | |||||||
| U5-638F | GCGCCCGAACAGGGACYTGAAARCGAAAG | 638 | 666 | NCR (downstream 5LTR) | NA | NA | fw |
| ProC- | GAGTATTGTATGGATTTTCAGGCCCAAT | 2,724 | 2,967 | pol (RT) | 613 (148) | 640 (175) | rc |
| 3 | |||||||
| VP5549F | AGAGGATAGATGGAACAAGCCCCAG | 5,550 | 5,574 | Vif (vpr) | 510 (1) | 534 (16) | fw |
| V3CR | TGCTCTTTTTTCTCTCTSCACCACT | 7,736 | 7,760 | gp160 (gp120) | 1512 (1512) | 1536 (1533) | rc |
| 4 | |||||||
| GP41Fi | GGACAATTGGAGAAGTGAATTAT | 7,652 | 7,674 | gp160 (gp120) | 1428 (1428) | 1450 (1450) | fw |
| U5-547R | GCACTCAAGGCAAGCTTTATTGAGGCTTA | 9,604 | 9,632 | LTR3 (LTR5) | 519 | 547 | rc |
| 5 | |||||||
| RT3626F | TGCCCACACTAATGATGTAA | 3,626 | 3,645 | pol (RT) | 1542 (1077) | 1561 (1096) | fw |
| SC02R | CTTCCTGCCATAGGAGATGCCTA | 5,980 | 5,958 | Tat1 (Rev1) | 128 (1) | 150 (11) | rc |
Bar plot of minor SNP frequencies across SGS amplicons. The expected consensus base (100%) is excluded. Each colored bar indicates the relative frequency of a minor allele at a given position. Low frequencies (<1–2%) are consistent with sequencing error, whereas high prevalence of higher peaks may suggest contamination or multiple templates.
Coverage of SGS amplicons across nucleotide positions. The y-axis shows the sequencing depth at each position on a log₁₀ scale. Bars indicate the number of reads supporting each base, with colors corresponding to the primer set used for amplification (faceted by primer). Uniform high coverage across the amplicon indicates reliable sequencing, while dips or gaps suggest regions of poor amplification or sequencing dropout.
Bar plot of minor SNP frequencies across SGS amplicons. The expected consensus base (100%) is excluded. Each colored bar indicates the relative frequency of a minor allele at a given position. Low frequencies (<1–2%) are consistent with sequencing error, whereas high prevalence of higher peaks may suggest contamination or multiple templates.
Coverage of SGS amplicons across nucleotide positions. The y-axis shows the sequencing depth at each position on a log₁₀ scale. Bars indicate the number of reads supporting each base, with colors corresponding to the primer set used for amplification (faceted by primer). Uniform high coverage across the amplicon indicates reliable sequencing, while dips or gaps suggest regions of poor amplification or sequencing dropout.